-
Experimental and Therapeutic Medicine Mar 2019The aim of the present study was to investigate the efficiency of the gene derived from pv. (Bga) on the identification of Bga from the complex (Bcc) based on the...
The aim of the present study was to investigate the efficiency of the gene derived from pv. (Bga) on the identification of Bga from the complex (Bcc) based on the COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy. A set of primers used for the specific amplification of the gene in Bga were designed according to the CODEHOP principle. A total of 1,644 bp of the gene sequence of Bga were acquired by CODEHOP amplification. The sequence was blasted in GenBank and it revealed an average of 86% similarity with the gene of nine genomovars of Bcc. A phylogenetic tree was constructed using the gene sequences. The microarray method was adopted to discriminate Bga from Bcc based on the specific probes designed upon the gene, and five genomovars of Bcc demonstrated a good discrimination from Bga on the microarray chip. CODEHOP strategy succeeded in amplification of the gene of Bga, which made it possible for the identification of Bga from five genomovars of Bcc.
PubMed: 30783462
DOI: 10.3892/etm.2018.7137 -
Foods (Basel, Switzerland) Jan 2024pv. is a serious safety issue in black fungus due to the deadly toxin, bongkrekic acid. This has triggered the demand for an efficient toxigenic phenotype recognition...
pv. is a serious safety issue in black fungus due to the deadly toxin, bongkrekic acid. This has triggered the demand for an efficient toxigenic phenotype recognition method. The objective of this study is to develop an efficient method for the recognition of toxin-producing strains. The potential of multilocus sequence typing and a back propagation neural network for the recognition of toxigenic was explored for the first time. The virulent strains were isolated from a black fungus cultivation environment in Qinba Mountain area, Shaanxi, China. A comprehensive evaluation of toxigenic capability of 26 isolates were conducted using Ultra Performance Liquid Chromatography for determination of bongkrekic acid and toxoflavin production in different culturing conditions and foods. The isolates produced bongkrekic acid in the range of 0.05-6.24 mg/L in black fungus and a highly toxin-producing strain generated 201.86 mg/L bongkrekic acid and 45.26 mg/L toxoflavin in co-cultivation with on PDA medium. Multilocus sequence typing phylogeny (MLST) analysis showed that housekeeping gene sequences have a certain relationship with a strain toxigenic phenotype. We developed a well-trained, back-propagation neutral network for prediction of toxigenic phenotype in based on MLST sequences with an accuracy of 100% in the training set and an accuracy of 86.7% in external test set strains. The BP neutral network offers a highly efficient approach to predict toxigenic phenotype of strains and contributes to hazard detection and safety surveillance.
PubMed: 38275718
DOI: 10.3390/foods13020351 -
Microorganisms Dec 2020In this study, we isolated an endophytic strain, named CGB10, from sugarcane leaves. CGB10 displayed strong inhibitory activity against filamentous growth of fungal...
In this study, we isolated an endophytic strain, named CGB10, from sugarcane leaves. CGB10 displayed strong inhibitory activity against filamentous growth of fungal pathogens, one of which is that causes sugarcane smut, a major disease affecting the quality and production of sugarcane in tropical and subtropical regions. CGB10 could effectively suppress sugarcane smut under field conditions, without itself causing any obvious damage or disease, thus underscoring a great potential as a biocontrol agent (BCA) for the management of sugarcane smut. A toxoflavin biosynthesis and transport gene cluster potentially responsible for such antifungal activity was identified in the CGB10 genome. Additionally, a quorum-sensing gene cluster was identified too and compared with two close species, thus supporting an overall connection to the regulation of toxoflavin synthesis therein. Overall, this work describes the in vitro and field biocontrol by a new B. gladioli strain, and reports genes and molecular mechanisms potentially involved.
PubMed: 33297590
DOI: 10.3390/microorganisms8121943 -
Plant Disease Jun 2007Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries...
Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.
PubMed: 30780491
DOI: 10.1094/PDIS-91-6-0767C -
Ochsner Journal 2022is a rare, gram-negative rod that was initially regarded as a plant pathogen. However, has been reported as the primary pathogen causing pneumonia in organ transplant...
is a rare, gram-negative rod that was initially regarded as a plant pathogen. However, has been reported as the primary pathogen causing pneumonia in organ transplant recipients and in patients with cystic fibrosis. We report a case of bacterial pneumonia caused by in a patient hospitalized for coronavirus disease 2019 (COVID-19). A 68-year-old male was admitted for acute hypoxic respiratory failure secondary to COVID-19 pneumonia. He was treated with dexamethasone and convalescent plasma, resulting in improvement in the hypoxemia. However, during the latter part of his inpatient stay, the patient developed pneumonia caused by . The isolate of was sensitive to meropenem, levofloxacin, and trimethoprim/sulfamethoxazole and intermediate to ceftazidime. He was treated with meropenem and levofloxacin. Despite treatment, the patient developed acute respiratory distress syndrome with multiorgan failure, suffered cardiac arrest, and died. To the best of our knowledge, this case is the first report of coinfection in a patient hospitalized for COVID-19 and provides insight into the possible detrimental outcome of and COVID-19 coinfection.
PubMed: 36561098
DOI: 10.31486/toj.22.0002 -
Biochemistry and Biophysics Reports Mar 2022Immobilization of lipase from BRM58833 on octyl sepharose (OCT) resulted in catalysts with higher activity and stability. Following, strategies were studied to further...
Immobilization of lipase from BRM58833 on octyl sepharose (OCT) resulted in catalysts with higher activity and stability. Following, strategies were studied to further stabilize and secure the enzyme to the support using functionalized polymers, like polyethylenimine (PEI) and aldehyde-dextran (DEXa), to cover the catalyst with layers at different combinations. Alternatively, the construction of a bifunctional layer was studied using methoxypolyethylene glycol amine (NH 2 -PEG) and glycine. The catalyst OCT-PEI-DEXa was the most thermostable, with a 263.8-fold increase in stability when compared to the control condition. When evaluated under alkaline conditions, OCT-DEXa-PEG 10 /Gly was the most stable, reaching stability 70.1 times greater than the control condition. Proportionally, the stabilization obtained for BRM58833 lipase was superior to that obtained for the commercial lipase. Preliminary results in the hydrolysis of fish oil demonstrated the potential of the coating technique with bifunctional polymers, resulting in a stable catalyst with greater catalytic capacity for the production of omega-3 PUFAs. According to the results obtained, it is possible to modulate BRM58833 lipase properties like stability and catalytic activity for enrichment of omega-3 fatty acids.
PubMed: 35128079
DOI: 10.1016/j.bbrep.2021.101193 -
Journal of Medical Microbiology Aug 2020complex (Bcc) bacteria, currently consisting of 23 closely related species, and , can cause serious and difficult-to-treat infections in people with cystic fibrosis.... (Comparative Study)
Comparative Study
complex (Bcc) bacteria, currently consisting of 23 closely related species, and , can cause serious and difficult-to-treat infections in people with cystic fibrosis. Identifying bacteria to the species level is considered important for understanding epidemiology and infection control, and predicting clinical outcomes. Matrix-assisted laser desorption/ionization time-of-flight MS (MALDI-TOF) is a rapid method recently introduced in clinical laboratories for bacterial species-level identification. However, reports on the ability of MALDI-TOF to accurately identify Bcc to the species level are mixed. The aim of this project was to evaluate the accuracy of MALDI-TOF using the Biotyper and VITEK MS systems in identifying isolates from 22 different Bcc species and compared to gene sequencing, which is considered the current gold standard for Bcc. To capture maximum intra-species variation, phylogenetic trees were constructed from concatenated multi-locus sequence typing alleles and clustered with a novel k-medoids approach. One hundred isolates representing 22 Bcc species, plus , were assessed for bacterial identifications using the two MALDI-TOF systems. At the genus level, 100 and 97.0 % of isolates were confidently identified as by the Biotyper and VITEK MS systems, respectively; moreover, 26.0 and 67.0 % of the isolates were correctly identified to the species level, respectively. In many, but not all, cases of species misidentification or failed identification, a representative library for that species was lacking. Currently available MALDI-TOF systems frequently do not accurately identify Bcc bacteria to the species level.
Topics: Animals; Bacterial Typing Techniques; Burkholderia cepacia; Burkholderia gladioli; Cluster Analysis; DNA, Bacterial; Fourier Analysis; Humans; Multilocus Sequence Typing; Phylogeny; Rec A Recombinases; Sequence Alignment; Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization
PubMed: 32597748
DOI: 10.1099/jmm.0.001223 -
Microbiology Spectrum Jun 2023Burkholderia gladioli strain NGJ1 exhibits mycophagous activity on a broad range of fungi, including Rhizoctonia solani, a devastating plant pathogen. Here, we...
Burkholderia gladioli strain NGJ1 exhibits mycophagous activity on a broad range of fungi, including Rhizoctonia solani, a devastating plant pathogen. Here, we demonstrate that the nicotinic acid (NA) catabolic pathway in NGJ1 is required for mycophagy. NGJ1 is auxotrophic to NA and it potentially senses R. solani as a NA source. Mutation in the and genes involved in NA catabolism renders defects in mycophagy and the mutant bacteria are unable to utilize R. solani extract as the sole nutrient source. As supplementation of NA, but not FA (fumaric acid, the end product of NA catabolism) restores the mycophagous ability of ΔΔ mutants, we anticipate that NA is not required as a carbon source for the bacterium during mycophagy. Notably, , a MarR-type of transcriptional regulator that functions as a negative regulator of the NA catabolic pathway is upregulated in Δ/Δ mutant and upon NA supplementation the expression is reduced to the basal level in both the mutants. The Δ mutant produces excessive biofilm and is completely defective in swimming motility. On the other hand, Δ/Δ mutants are compromised in swimming motility as well as biofilm formation, potentially due to the upregulation of . Our data suggest that a defect in NA catabolism alters the NA pool in the bacterium and upregulates which in turn suppresses bacterial motility as well as biofilm formation, leading to mycophagy defects. Mycophagy is an important trait through which certain bacteria forage over fungal mycelia and utilize fungal biomass as a nutrient source to thrive in hostile environments. The present study emphasizes that nicotinic acid (NA) is important for bacterial motility and biofilm formation during mycophagy by Burkholderia gladioli strain NGJ1. Defects in NA catabolism potentially alter the cellular NA pool, upregulate the expression of , a negative regulator of biofilm, and therefore suppress bacterial motility as well as biofilm formation, leading to mycophagy defects.
Topics: Burkholderia gladioli; Niacin; Bacteria; Biofilms; Mutation; Bacterial Proteins; Gene Expression Regulation, Bacterial
PubMed: 37014254
DOI: 10.1128/spectrum.04457-22 -
Molecules (Basel, Switzerland) Jan 2021A strain, named BBB-01, was isolated from rice shoots based on the confrontation plate assay activity against several plant pathogenic fungi. The genome of this...
A strain, named BBB-01, was isolated from rice shoots based on the confrontation plate assay activity against several plant pathogenic fungi. The genome of this bacterial strain consists of two circular chromosomes and one plasmid with 8,201,484 base pairs in total. Pangenome analysis of 23 strains suggests that BBB-01 has the closest evolutionary relationship to pv. and pv. . BBB-01 emitted dimethyl disulfide and 2,5-dimethylfuran when it was cultivated in lysogeny broth and potato dextrose broth, respectively. Dimethyl disulfide is a well-known pesticide, while the bioactivity of 2,5-dimethylfuran has not been reported. In this study, the inhibition activity of the vapor of these two compounds was examined against phytopathogenic fungi, including , , , and , and human pathogen . In general, 2,5-dimethylfuran is more potent than dimethyl disulfide in suppressing the growth of the tested fungi, suggesting that 2,5-dimethylfuran is a potential fumigant to control plant fungal disease.
Topics: Antifungal Agents; Burkholderia gladioli; Plant Diseases; Volatile Organic Compounds
PubMed: 33572680
DOI: 10.3390/molecules26030745 -
Journal of Clinical Microbiology May 2009Burkholderia gladioli, primarily known as a plant pathogen, is involved in human infections, especially in patients with cystic fibrosis (CF). In the present study, the...
Burkholderia gladioli, primarily known as a plant pathogen, is involved in human infections, especially in patients with cystic fibrosis (CF). In the present study, the first respiratory isolates recovered from 14 French patients with CF and 4 French patients without CF, identified by 16S rRNA gene analysis, were tested for growth on B. cepacia selective media, for identification by commercial systems, and for their antimicrobial susceptibilities, and were compared by pulsed-field gel electrophoresis (PFGE). Patients' data were collected. All 18 isolates grew on oxidation-fermentation-polymyxin B-bacitracin-lactose medium and Pseudomonas cepacia agar, but only 13 grew on Burkholderia cepacia selective agar. API 20NE strips did not differentiate B. gladioli from B. cepacia, whereas Vitek 2 GN cards correctly identified 15 isolates. All isolates were susceptible to piperacillin, imipenem, aminoglycosides, and ciprofloxacin and were far less resistant to ticarcillin than B. cepacia complex organisms. Fifteen PFGE types were observed among the 18 isolates, but shared types were not identified among epidemiologically related patients. The microbiological follow-up of CF patients showed that colonization was persistent in 3 of 13 documented cases; B. gladioli was isolated from posttransplantation cultures of blood from 1 patient. Among the patients without CF, B. gladioli was associated with intubation (three cases) or bronchiectasis (one case). In summary, the inclusion of B. gladioli in the databases of commercial identification systems should improve the diagnostic capabilities of those systems. In CF patients, this organism is more frequently involved in transient infections than in chronic infections, but it may be responsible for complications posttransplantation; patient-to-patient transmission has not been demonstrated to date. Lastly, B. gladioli appears to be naturally susceptible to aminoglycosides and ciprofloxacin, although resistant isolates may emerge in the course of chronic infections.
Topics: Adolescent; Adult; Anti-Bacterial Agents; Bacterial Typing Techniques; Burkholderia Infections; Burkholderia gladioli; Child; Child, Preschool; Cluster Analysis; Cystic Fibrosis; DNA Fingerprinting; DNA, Bacterial; DNA, Ribosomal; Electrophoresis, Gel, Pulsed-Field; Female; France; Genotype; Humans; Male; Microbial Sensitivity Tests; RNA, Ribosomal, 16S; Sequence Analysis, DNA; Young Adult
PubMed: 19297595
DOI: 10.1128/JCM.02489-08